Bypass navigation and go to content


Content
1 Data statistics
  1.1 Species
  1.2 Microarray experiments
  1.3 MiRNA and targets
2 Utilities
  2.1 Basic Information
      2.1.1 By miRNA
      2.1.2 By experiment
      2.1.3 By target gene ID
     2.1.4 By target prediction
  2.2 Meta-Network
      2.2.1 Search
      2.2.2 Browse

1 Data statistics

1.1 Species


1.2 Microarray experiments
Species #Experiment #Array
Total 0 0

1.3 MiRNA and targets
Species #MiRNA #Target
Total 0 0

2 Utilities

2.1 Basic Information

  Search miRNA targets, retrieve expression data and perform clustering on differentially expressed genes.

2.1.1 By miRNA

Search target gene expression patterns by searching or browsing a validated miRNA name(Fig.1).
When search a miRNA, both a complete or partial name are accepted, for example, we first select the entry of “By miRNA identifier or keyword”, then select “Arabidopsis thaliana” and input keyword ‘miR156’, then the result will list 14 members of miRNA family MIR156 in Arabidopsis thaliana, such as ath-miR156a, ath-miR156b, ath-miR156c, etc(Fig.2).

Fig.1. Page of Basic Information search By miRNA.
Fig.2 Result of Basic Information search By miRNA with miR156.

From the result table we could see the mature sequence and the number of predicted targets of each miRNA. Then, click the hyperlink on each miRNA name will lead to miRBase for more information of the corresponding miRNA and the hyperlink on the number of targets will lead users to information page of target genes. Here, we take ath-miR156a for example. Click the number of its target genes, i.e. 20, and then on the top of the target information page appear subsequently, there are 4 hyperlinks following each target gene(Fig.3):

Fig.3. Part of ath-miR156a target gene list.

Sequence, show users the its sequence and the target loci in green.

Alignment, display the alignment of the target and miRNA regulating it.

Expression, provide expression data of the corresponding target in all the experiments in which it expresses differentially. Use the checkbox to select multiple experiments and use the image after experiment title to select single one(Fig.4). The result obtained is shown in Fig.5.

Fig.4 Part of experiment list. In all the experiment here target gene AT1G27370.1 expressed differentially.
Fig.5 Categoryplot of expression profile of AT1G27370.1 in experiment “AtGenExpress: Developmental series (roots)”.

Under each categoryplot, there is one buttons named Barplot for Single Target, which shows users the detail expression profiles in each biological repeats using barplot (Fig.6.).

Fig.6 Barplot of expression profile of AT1G27370.1 in experiment “AtGenExpress: Developmental series (roots)”.

Gene Ontology, show the Gene Ontology terms the corresponding genes belongs to in the format of both a minimal GO graph drawn by the visualize function of AmiGO API (Carbon, et al., 2009, Fig.13.) and text table.

Fig.7 A minimal GO graph of AT1G27370.1.
2.1.2 By experiment

Search target gene expression patterns by key words in experiment annotations.
Also start with a search entry and a complete list of all the experiment. User could select interested experiment from the list or search certain one meets certain subject, i.e. ‘drought’ (Fig.8), and after each experiment title, their are 3 hyperlinks leading to 3 type of information:

Fig.8 List of high quality experiments focusing on drought stress in Arabidopsis thaliana. Users can control the experiments quality via the "quality control" list.

Information: retrieve the experiment design information.
Target Expression: retrieve expression profiles of targets of each miRNA in the selected organism with the format of categoryplot (Fig.9).

Fig.9 Expression profile of ath-miR156a target genes in experiment “Time of day shapes the Arabidopsis drought transcriptomes ”. Change miRNA via the miRNA list in the upper left.


The button of "barplot for single target" is for the detail expression profile in each biological repeats, similar to Fig.6.
Differential Expression: provides all the differentially expressed target genes of all the validated miRNA in the current organism. Corresponding information includes gene identifier, the log2 value of fold change, p_value, and the condition pair between which its expression various significantly (Fig.10).

Fig.10. Part of target gene list which expressed differentially in experiment “Time of day shapes the Arabidopsis drought transcriptomes”.
2.1.3 By target gene ID

Search target gene expression patterns by their IDs. Also start with a search entry and a complete list of all the targets of validated miRNAs(Fig.11). For species with genome completed sequenced, CDNA identifier is acceptable; for other species, plantGDB identifier is acceptable. Example of gene identifier accepted is as shown in the table below:

speciesgene_id

Fig.11 Page of Basic Information By gene ID.

The result obtained from this entry is as the same as Fig.3.

2.1.4 By target prediction

  Predict your miRNA targets and retrieve their microarray expression data. This function enables our database to serve for user's putitive novel miRNAs.
MiRNA target genes were predicted using the first criterion used by Allen et al. (2005). To perform this function, users should select the correct organism, input miRNA sequences in FASTA format and input the threshold of score, default is 4, then it will predict target genes for the input miRNA and give out all their expression information and analysis result.
For example, we input a sequence of UGACAGAAGAGAGUGAGCAC named novel1, and select Arabidopthis thaliana (Fig.12), then it will lead users to page of target information shown in Fig.3, except for the target genes are predicted just now.

Fig.12 Page of Basic Information By target prediction.
2.2 Meta-Network

Perform a combinatorial query of annotated bio-processes, species, and miRNA family names.

2.2.1 Search

Perform a meta-anlysis by selecting bioprocesses and/or multiple species and/or miRNAs(Fig.13). The result obtained is as shown in Fig.14.

Fig.13 Homepage of Meta-Network Search.
Fig.14 Result of Meta-Network Search.

Each row represents a relation.
The first 6 columns in order means in which type of bio-process, of which biological term, which miRNA family has any target gene expressed significantly in the corresponding experiment focusing on that biological term, and the max cv value is represented by the width of the red rectangle. The 7th column means that besides the species you selected, in which other species there is also data supporting this relation, and the last column shows that besides the bio-term represented in the second column, which biological terms also have relation with the corresponding miRNA family.
Take the last second row for example, the first 6 columns mean that in Arabidopsis thaliana miR399 is relational to leaf development, the experiment supporting this relation is GSE3416, and the max cv value of miR399 target gene is 0.085. The 7th column of the result table means that besides Arabidopsis thaliana, in Medicago truncatula there also exists this relationship. The 8th column means that besides leaf development, miR399 is also related to seedling, stem, embryogenesis and root development.
Besides the text information showed in the table, users could also get some extra information via clicking the hyperlinks in the table mainly in the format of structured graph drawn by cytoscape web program.

First, click the hyperlink on each bio-process, users could get all the relation between this type of bio-process and miRNA family in each species (change species via the selection list in the left top of the result page, Fig.15).

Fig.15 Relation between development and miRNA family in Zea Mays.

  Different types of nodes (miRNA family, bio-process, single experiment) are represented with different colors. The width of edge to experiment node represents the max fold change (log2 value) of the targets in the corresponding experiment, and the width of the other edges represents the max CV of the network immediately below.
  The graphical network can be manipulated in a number of features:

(1) Click the edges to see CV value or fold change value of targets.
(2) Users can draw a node to place it in a comfortable position. We also provide a “Recalculate layout” button to make the layout more clearly structured especially after users append some children nodes.
(3) Click the miRNA family node in the graph will expand its children node represents which biological term of the selected bio-process it is related to, and the children nodes of biological term node representing which datasets supporting the corresponding relation (Fig.16). For example, click node miR396, we can get that miR396 is related with embryo, seeding, endosperm and immature ear development in Zea Mays, and there are separately one dataset supporting these relations.
Fig.16 Relation between miR396 and development in Zea Mays.
(4) Click the dataset node will give you the detail expression profile of the corresponding miRNA target genes differentially expressed in the dataset.
(5) Click the label “reload” will reload the graph.
(6) The manipulate panel in the right bottom corner of the page could help to resize the picture.

  Second, click the hyperlink on each biological term will give you all the relation between this biological term and miRNA family in each species (Fig.17).

Fig.17 Relation between Endosperm development and miRNA family in Zea Mays.

  The way interacting with graph is the same as above. Except for clicking the miRNA family node will give the related dataset straightly (Fig.18).

Fig.18 Relation between embryo development and miRNA family in Zea Mays.

  Third, click the hyperlink on the miRNA family will give you all the relation between this miRNA and bio-process (Fig.19). And click the biological term node will give the related dataset (Fig.20). The other operation is as the same as above.

Fig.19 Relation between miR395 and 3 types of bio-process.
Fig.20 Relation between miR395 and 3 types of bio-process.

Fifth, Click the experiment node will give you the detail expression profile of the corresponding miRNA target genes differentially expressed.

2.2.2 Browse

Browse all the relations in the selected scope.


For suggestions, please contact web Administrator
IE 9 & 1024×768 Resolution Suggested